Acquisition Of Htlv Primer And Probes And Endogenous Internal Control Albumin, By Electronic Bidding With Fund. In Art. 75, Inc. Ii Of Law No. 14,133/21, Aiming To Meet Lacen/Pe *

  Address - Brazil

  Contact details - 565656565

  Tender notice no. - 76454545

  GT Ref Id - 106076051

  Document Type - Tender Notices

Description - notice_title: Acquisition Of Htlv Primer And Probes And Endogenous Internal Control Albumin, By Electronic Bidding With Fund. In Art. 75, Inc. Ii Of Law No. 14,133/21, Aiming To Meet Lacen/Pe *local title:: Aquisição de PRIMERS E SONDAS DE HTLV E C ONTROLE INTERNO ENDÓGENO ALBUMINA, por meio de Dispensa Eletrônica de licitação com fund. no art. 75, inc. II da Lei nº 14.133/21, visando atender o LACEN/PE * lot_details: 1: REAGENTE PARA BIOLOGIA MOLECULAR OLIGONUCLEOTIDEO COM 27 PARES DE BASES, PRIMER SENSO GENE POL PARA REACAO DE RTPCR EM TEMPO REAL PARA HTLV1,PRIMER SENSO: 5'GAACGCTCTAATGGCATTCTTAAAACC3', 2: REAGENTE PARA BIOLOGIA MOLECULAR OLIGONUCLEOTIDEO COM 24 PARES DE BASES, PRIME

Gt Ref Id - 106076051

Deadline - Apr 02, 2025